- How to open a large text file to see data how to#
- How to open a large text file to see data code#
- How to open a large text file to see data download#
I'm sure that you will notice how smooth Python makes it to navigate through such an extremely large text file without having any issues. Whenever you want to quit, you just need to type STOP (case sensitive) in your terminal. User_input = input('Type STOP to quit, otherwise press the Enter/Return key ')Īs you can see from this script, you can now read and navigate through the large text file immediately using your terminal. To do that, we can simply use Python to read the text file through the terminal screen as follows (navigating through the file 50 lines at a time): with open('hg38.txt','r') as input_file: Navigating Through Large Text FilesĪlthough the above step allowed us to read large text files by extracting lines from that large file and sending those lines to another text file, directly navigating through the large file without the need to extract it line by line would be a preferable idea. with open('hg38.txt', 'r') as input_file, open('output.txt', 'w') as output_file:īut say that we wanted to directly navigate through the text file without extracting it line by line and sending that to another text file, especially since this way seems more flexible. This way, the context managers will automatically take care of freeing up resources once the file no longer needs to be read.
How to open a large text file to see data code#
Our code for reading the text file could be made more secure and readable by using the with statement in Python. GGAGCCGGAGCGTCAGAGCCACCCACGACCACCGGCACGCCCCCACCACA GCCTCCTCTCGCCGCAGGTCTGGCTGGATGAAGGGCACGGCATAGGTCTGĪCCTGCCAGGGAGTGCTGCATCCTCACAGGAGTCATGGTGCCTGTGGGTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNĬTCCAGAGACCTTCTGCAGGTACTGCAGGGCATCCGCCATCTGCTGGACG Notice that we read 500 lines from hg38.txt, line by line, and wrote those lines to a new text file output.txt, which should look as shown below: >chr1 It only returns an empty string when we reach the end of the file. The newline character at the end of each line in the file is returned untouched by readline(). On the next line, we use open() again, but this time we pass the w flag because we want to write the contents of our original file to the new file.Īfter that, we iterate over the first 500 lines in hg38.txt by using the readline() method. The r passed as the second parameter means that we intend to read the contents of hg38.txt. We begin by using the built-in open() function in Python to open our file and get back a file object. We can simply do the following: input_file = open('hg38.txt','r') Let's say we wanted to read the first 500 lines from our large text file. In this section, we are going to see how we can read our large file using Python.
How to open a large text file to see data how to#
In this quick tip, we will see how to do that using Python. Having a guaranteed way to open such extremely large files would be a nice idea. I first tried using Microsoft Word to open the file, and got the following message:Īlthough opening the file also didn't work using WordPad and Notepad on a Windows-based machine, it did open using TextEdit on a macOS machine.īut you get the point. Let's see what happens when we try to do that. What I mean here by the traditional way is using our word processor or text editor to open the file. Rename it to hg38.txt to obtain a text file. You can use 7-zip to unzip the file, or any other tool you prefer.Īfter you unzip the file, you will get a file called hg38.fa.
How to open a large text file to see data download#
Go ahead and download hg38.fa.gz (please be careful, the file is 938 MB). What matters in this tutorial is the concept of reading extremely large text files using Python. I don't want you to worry if you didn't understand the above statement, as it is related to Genetics terminology. Repeats from RepeatMasker and Tandem Repeats Finder (with period of 12 or less) are shown in lower case non-repeating sequence is shown in upper case. The file we will be using in particular is the hg38.fa.gz file, which as described here, is: "Soft-masked" assembly sequence in one file. In this tutorial, we will be obtaining this file from the UCSC Genome Bioinformatics downloads website. In order to carry out our experiment, we need an extremely large text file. Well, let's see some evidence on whether we would need Python for reading such files or not. Let me start directly by asking, do we really need Python to read large text files? Wouldn't our normal word processor or text editor suffice for that? When I mention large here, I mean extremely large files!